The home page as well as the search pageallows search queries in a number of ways. Searching can be done by choosing the organism, type of cancer, miRNA name ( e.g hsa-let-7a*), microRNA sequence (e.g CUAUACAAUCUACUGUCUUUC) or its Accession no. (e.gMIMAT0004481) or the target gene (e.g BRCA 2 ).
Search page
Results
The displayed page has the information of the miRNAs, Sequence, Accession Number, Target gene, target description, chromosome number and gene location and oncogenic Pathways it represents.
